5-DNA 1317

Aberrant DNA Methylation of Two Tumor Suppressor Genes, p14ARF and p15INK4b, after Chronic Occupational Exposure to Low Level of Benzene

1Petroleum Industry Health Organization, Assaluyeh, Bushehr, Iran

2Department of Medical Biotechnology, National Institute for Genetic Engineering and Biotechnology, Tehran, Iran

3Center for Research on Occupational Diseases (CROD), School of Medicine, Tehran University of Medical Sciences (TUMS), Tehran, Iran

Correspondence to
Frouzandeh Mahjoubi, National Institute of Genetic Engineering and Biotechnology, Shahrak-e Pajoohesh, km 15, Tehran-Karaj Highway

PO Box: 14965/161, Tehran, Iran

Tel: +98-21-4478-7389

Fax: +98-21-4478-7399

E-mail: frouz@nigeb.ac.ir

Received: Mar 12, 2018

Accepted: May 3, 2018

Abstract

Background: Exposure to benzene would be associated with many diseases including leukemia. Epigenetic alterations seem to be among the main mechanisms involved.

Objective: To determine if chronic occupational exposure to low level of benzene would be associated with DNA methylation.

Methods: Global DNA methylation and promoter-specific methylation of the two tumor suppressor genes, p14ARF and p15INK4b, were assessed employing methylation-specific PCR using the DNA extracted from 40 petrochemical workers exposed to ambient benzene levels of <1 ppm, and 31 office workers not exposed to benzene or its derivatives.

Results: While an increase in global DNA methylation of 5% in p14ARF (p=0.501) and 28% in p15INK4b (p=0.02) genes was observed in the exposed group, no hypermethylation in either of the studied genes was observed in the unexposed group. No significant association was found between the frequency of aberrant methylation and either of age, work experience, and smoking habit in the exposed group.

Conclusion: Chronic occupational exposure to lower than the permissible exposure limit of benzene may still result in DNA methylation of tumor suppressor genes that may ultimately lead to development of cancer.

Keywords: Benzene; DNA methylation; Genes, tumor suppressor; Tumor suppressor protein p14ARF; Cyclin-dependent kinase inhibitor p15; Neoplasms

Introduction

Widely used in various industries, benzene (CAS 71-43-2) is one of the predominant air pollutants.1 Chronic exposure to benzene can cause aplastic anemia and increase the risk of some blood dyscrasia including acute myelogenous leukemia.2,3 Epigenetic changes in response to chronic exposures to benzene are among the main mechanisms of concern recently under extensive study.

DNA methylation is an important epigenetic mechanism, which often occurs in response to environmental stimuli and is crucial in regulating gene expression. Global DNA hypomethylation and promoter hypermethylation of tumor suppressor genes are frequently observed in hematological malignancies.2 Aberrant methylation changes of specific genes or regions associated with inefficient gene products can be induced by environmental pollutants.3-5 Hypermethylation of tumor suppressor genes has the potential to be a valuable biomarker for the extent of exposure to benzene.6

Located at 9p21 gene cluster region, p14ARF and p15INK4b anti-oncogenes have important roles in regulating cell proliferation.7 This makes this gene cluster a target for selective inactivation during carcinogenic process.8 High agglomeration of CpG islands on promoter regions of these genes predisposes them to often be inactivated by promoter methylation.9,10 Inactivation of p14ARF and p15INK4b genes by altered promoter methylation has been demonstrated in some types of malignancies.11

We previously showed that exposure to low level of benzene does not increase the frequency of micronucleus, nucleoplasmic bridge, and nuclear budding in the peripheral blood lymphocytes, biomarkers for DNA damage, in a group of petrochemical workers.12 We conducted this study to determine if chronic occupational exposure to low level of benzene is associated with the extent of methylation of the p14ARF and p15INK4b promoter CpG islands.

Materials and Methods

In a cross-sectional study, 40 workers exposed to low level of benzene and 31 unexposed workers were studied. The exposed people included 40 petrochemical male workers selected from the production unit of a petrochemical plant who had been exposed to benzene levels of <1 ppm (lower than the permissible exposure limit), confirmed based on periodic environmental monitoring, for at least five years. The 31 unexposed people were office workers selected from the same area who had not been exposed to benzene or other related derivatives.

Those with history of chemotherapy, radiotherapy, x-ray exposure, serious infections, and consumption of genotoxic drugs or supplemental vitamins during the previous six months were excluded from the study. Peripheral blood samples were collected in tubes containing 0.05 M EDTA. All samples were stored at 4 °C and transported to the laboratory within 8 hrs.

DNA Extraction

Genomic DNA was isolated from whole blood using a rapid genomic DNA isolation kit (MBST, Iran) according to the manufacturer's directions. The purity and concentration of the extracted genomic DNA were determined by nanodrop spectrophotometry.

Bisulfite Treatment, Methylation-Specific PCR (MS-PCR)

The extracted DNA was treated with sodium bisulfite to convert all unmethylated cytosines to uracils. Bisulfite conversion was performed with the EpiTect Bisulfite kit (Qiagen, Germany) on 2 μg DNA.

MS-PCR included two separate PCR reactions using methylated/unmethylated-specific amplifiers flanking the CpG-rich p14ARF and p15INK4b promoter regions. MS-PCR was carried out according to the conventional procedure previously mentioned by Herman, et al.13

EpiTect control DNA (Qiagen, Germany) and MyoD gene amplification with primers selected in an unmethylated region, were served as positive methylated and bisulfite treatment controls, respectively. In the meantime, a blank control without DNA template was used for co-amplification. The primer sequences (Table 1) and PCR conditions for p14ARF, p15INK4b and MyoD genes are reported elsewhere.14,15 PCR products were electrophoresed on a 2% agarose gel.

Table 1: Primers for methylation-specific PCR

Primer

Forward sequence

Reverse sequence

Product size (bp)

p14ARF M

5' GTGTTAAAGGGCGGCGTAGC 3'

5' AAAACCCTCACTCGCGACGA 3'

122

p14ARF UM

5' TTTTTGGTGTTAAAGGGTGGTGTAGT 3'

5' CACAAAAACCCTCACTCACAACAA 3'

132

p15INK4b M

5' GCGTTCGTATTTTGCGGTT 3'

5' CGTACAATAACCGAACGACCGA 3'

148

p15INK4b UM

5' TGTGATGTGTTTGTATTTTGTGGTT 3'

5' CCATACAATAACCAAACAACCAA 3'

154

MyoD

5' TGATTAATTTAGATTGGGTTTAGAGAAGGA 3'

5' CCAACTCCAAATCCCCTCTCTAT 3'

152

Ethics

The study protocol was approved by the Ethics Committee of Tehran University of Medical Sciences, Tehran, Iran. Written informed consent was obtained from each study participant.

Statistical Analysis

IBM SPSS® for Windows® ver 22.0 was used for data analysis. The distribution of observed methylation frequencies was compared between exposed and unexposed groups using Fisher's exact test. A p value <0.05 was considered statistically significant.

Results

The mean age of exposed group, 33.1 (SD 3.2) years, was significantly (p=0.011) lesser than that for unexposed group (35.8 [SD 5.4] years). The mean work experience in the exposed group, 8.7 (SD 2.7) years, was also significantly (p=0.014) lesser than that for the unexposed group (11.2 [SD 5.5] years). Five (13%) of 40 exposed and two (6%) of 31 unexposed workers were current smokers (p=0.457). None of the participants reported alcohol consumption.

p14ARF and p15INK4b Methylation

No one in the unexposed group had promoter hypermethylation in p14ARF and p15INK4b genes. Aberrant methylation of p14ARF gene was detected in two (5%) exposed workers. p15INK4b methylation was found in 11 (28%) exposed workers. Although the methylation rate was significantly (p=0.02) higher in p15INK4b gene compared to that in the unexposed group, it was not significantly (p=0.501) different for p14ARF gene between exposed and unexposed groups. None of the exposed workers had methylation of both studied genes.

One worker with methylated p14ARF and five of those with p15INK4b methylation had a PCR product corresponding to the unmethylated DNA sequence (Fig 1). No significant association was observed between the status of the studied genes promoter methylation and either of age, work experience, and smoking status. No association was also observed between the studied genes methylation and the frequency of micronucleus, nucleoplasmic bridge, and nuclear budding in the peripheral blood lymphocytes (data not shown).12

Figure 1: A representative agarose gel demonstrating the methylation-specific PCR products of (A) p14ARF and (B) p15INK4b. The PCR products were run on a 2% agarose gel. EpiTect control DNA and MyoD amplification were used respectively, as positive methylated and bisulfite treatment controls. Blank control without DNA template was used as negative control. M: methylated primer; UM: unmethylated primer

5-DNA%201317-1.tif

a: Gel documentation for p14ARF promoter region by methylation-specific PCR. Lane 1: positive p14ARF methylated control (122 bp); Lane 2: negative control; Lane 3: positive bisulfite treatment controls (154 bp); Lanes 4–6: samples from exposed workers

5-DNA%201317-2.tif

b: Gel documentation for p15INK4b promoter region by methylation-specific PCR. Lane 1: positive p15INK4b methylated control (148 bp); Lane 2: negative control; Lanes 3–5: samples from exposed workers

Discussion

We found that methylation of p15INK4b gene (but not p14ARF) was significantly associated with chronic exposure to low level of benzene. This was not dose-dependent. Previous studies on environmental chemical exposures and human epigenetics show that exposure to low-level airborne benzene is associated with alterations in DNA methylation in blood DNA,16 and hypermethylation of p15INK4b gene.4 An increase in p15INK4b methylation is reported after exposure to arsenic too.17 Bollati, et al, also show significant association between p15INK4b hypermethylation with increasing airborne benzene levels in a group of gas station attendants and police officers exposed to low level of benzene.16

The significant role of epigenetic alterations in benzene carcinogenicity has recently been reported.6 Many of the epigenetic changes observed in response to environmental exposures may be mechanistically associated with susceptibility to several diseases.1 Gene-specific DNA methylation has also been reported in individuals exposed to benzene.18

Contradictory results on methylation of tumor suppressor genes have been reported in various studies. For example, in a Bulgarian population, gene-specific hypomethylation of p15INK4b is reported after exposure to benzene.19 This observation is in direct contradiction to the results reported by Bollati, et al.16 This reflects that epigenetic response to environmental stimuli is variable—the same environmental pollutant may produce different epigenetic changes in different ethnic groups, tissues, and even within the same tissue on different cell types.4 However, the majority of results support the increase in p15INK4b promoter methylation in response to exposure to benzene in accordance to our results.

Studies on molecular changes of p14ARF and occupational exposure are very limited and more focused on genetic modifications such as gene polymorphism.20 Studies on the epigenetic alterations of p14ARF are almost limited to cancer, not focused on airborne pollutants, especially benzene.

Higher rates of p14ARF and p15INK4b methylation are reported in coke oven workers exposed to airborne benzo[a]pyrene (10.7% and 22.3%, respectively) where the frequency of p14ARF hypermethylation depends on work experience; that of p15INK4b does not.21 Our findings did not reveal any associations between the frequency of promoter methylation of p14ARF and p15INK4b and either of age, smoking habit, and work experience. That would be attributed to the low sample size of our study. Nonetheless, our observation of no consistent association between the aberrant methylation and smoking, as a source of benzene,16 was in line with previous reports.16,17 This might be a result of a mixture of a high number of agents with complex synergic effects that could level off the effect of the tobacco-derived benzene.16 DNA methylation is an age-dependent process.11 However, all of our participants were almost young and no association was observed between the frequency of methylation and the age of participants.

Inactivation of p14ARF would result in degradation of the p53 protein,22 a potential target for methylation in cancer. Hypermethylation of p15INK4b would also result in a five-fold increase in the risk of p53 methylation.23 Both genes are members of the INK4 family of cyclin-dependent kinase (CDK) inhibitors located at the same chromosomal region. Accumulation of methylation aberrancies at their promoter region, which is common mechanism for loss of tumor suppressor genes function,24 represent potential step towards development of malignancies.

Our previous work show no effect of chronic exposure to low level of benzene on peripheral blood elements.12 However, findings of our current study of aberrant epigenetic changes in those chronically exposed to lower than the permissible exposure limit of benzene would raise the concern about the potential toxicity of benzene.

Our study had several limitations. Because of the cross-sectional nature of the study, we could not make any cause and effect relationship between the observed DNA methylation and the exposure. Furthermore, we could not be sure how accurate was the periodic measurements of the ambient benzene in the studied unit. Another covariate was that the workers in the unit had not been solely exposed to benzene; they had been exposed to various chemicals the effects of which on DNA methylation were not considered in our analyses.

In conclusion, chronic exposure to low level of benzene might cause hypermethylation of tumor suppressing genes. This would result in many occupational-related malignancies. Further well-controlled studies should be conducted to shed light on this important issue.

Conflicts of Interest: None declared.

Financial Support: This work was supported by Tehran University of Medical Sciences (TUMS) under grant number 92-03-109-24328 and National Institute for Genetic Engineering and Biotechnology (NIGEB). We would like to thank all participants who enabled us to conduct this study.

References

  1. Fenga C, Gangemi S, Costa C. Benzene exposure is associated with epigenetic changes (Review). Mol Med Rep 2016;13:3401-5.
  2. Esteller M. Profiling aberrant DNA methylation in hematologic neoplasms: a view from the tip of the iceberg. Clin Immunol 2003;109:80-8.
  3. Gronniger E, Weber B, Heil O, et al. Aging and chronic sun exposure cause distinct epigenetic changes in human skin. PLoS Genet 2010;6:e1000971.
  4. Hou L, Zhang X, Wang D, Baccarelli A. Environmental chemical exposures and human epigenetics. Int J Epidemiol 2012;41:79-105.
  5. Stein RA. Epigenetics and environmental exposures. J Epidemiol Community Health 2012;66:8-13.
  6. Yang J, Zuo X, Bai W, et al. PTEN methylation involved in benzene-induced hematotoxicity. Exp Mol Pathol 2014;96:300-6.
  7. Carnero A, Hannon GJ. The INK4 family of CDK inhibitors. Curr Top Microbiol Immunol 1998;227:43-55.
  8. Xing EP, Nie Y, Song Y, et al. Mechanisms of inactivation of p14ARF, p15INK4b, and p16INK4a genes in human esophageal squamous cell carcinoma. Clin Cancer Res 1999;5:2704-13.
  9. Robertson KD, Jones PA. The human ARF cell cycle regulatory gene promoter is a CpG island which can be silenced by DNA methylation and down-regulated by wild-type p53. Mol Cell Biol 1998;18:6457-73.
  10. Savic S, Franco N, Grilli B, et al. Fluorescence in situ hybridization in the definitive diagnosis of malignant mesothelioma in effusion cytology. Chest 2010;138:137-44.
  11. Jarmalaite S, Kannio A, Anttila S, et al. Aberrant p16 promoter methylation in smokers and former smokers with nonsmall cell lung cancer. Int J Cancer 2003;106:913-8.
  12. Jamebozorgi I, Mahjoubi F, Pouryaghoub G, et al. Micronucleus, Nucleoplasmic Bridge, and Nuclear Budding in Peripheral Blood Cells of Workers Exposed to Low Level Benzene. Int J Occup Environ Med 2016;7:227-33.
  13. Herman JG, Graff JR, Myohanen S, et al. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 1996;93:9821-6.
  14. Furonaka O, Takeshima Y, Awaya H, et al. Aberrant methylation of p14(ARF), p15(INK4b) and p16(INK4a) genes and location of the primary site in pulmonary squamous cell carcinoma. Pathol Int 2004;54:549-55.
  15. Kawakami K, Brabender J, Lord RV, et al. Hypermethylated APC DNA in plasma and prognosis of patients with esophageal adenocarcinoma. J Natl Cancer Inst 2000;92:1805-11.
  16. Bollati V, Baccarelli A, Hou L, et al. Changes in DNA methylation patterns in subjects exposed to low-dose benzene. Cancer Res 2007;67:876-80.
  17. Aihua Zhanga CG, Xue Hana, Lifang Wanga, et al. Inactivation of p15INK4b in chronic arsenic poisoning cases. Toxicology Reports 2014;1:692-8.
  18. Chappell G, Pogribny IP, Guyton KZ, Rusyn I. Epigenetic alterations induced by genotoxic occupational and environmental human chemical carcinogens: A systematic literature review. Mutat Res Rev Mutat Res 2016;768:27-45.
  19. Seow WJ, Pesatori AC, Dimont E, et al. Urinary benzene biomarkers and DNA methylation in Bulgarian petrochemical workers: study findings and comparison of linear and beta regression models. PLoS One 2012;7:e50471.
  20. Sun P, Zhang Z, Wan J, et al. Association of genetic polymorphisms in GADD45A, MDM2, and p14 ARF with the risk of chronic benzene poisoning in a Chinese occupational population. Toxicol Appl Pharmacol 2009;240:66-72.
  21. Zhang H, Li X, Ge L, et al. Methylation of CpG island of p14(ARK), p15(INK4b) and p16(INK4a) genes in coke oven workers. Hum Exp Toxicol 2015;34:191-7.
  22. Esteller M, Tortola S, Toyota M, et al. Hypermethylation-associated inactivation of p14(ARF) is independent of p16(INK4a) methylation and p53 mutational status. Cancer Res 2000;60:129-33.
  23. Bodoor K, Haddad Y, Alkhateeb A, et al. DNA hypermethylation of cell cycle (p15 and p16) and apoptotic (p14, p53, DAPK and TMS1) genes in peripheral blood of leukemia patients. Asian Pac J Cancer Prev 2014;15:75-84.
  24. Li J, Bi L, Lin Y, et al. Clinicopathological significance and potential drug target of p15INK4B in multiple myeloma. Drug Des Devel Ther 2014;8:2129-36.

TAKE-HOME MESSAGE

  • Benzene, one of the most widely used industrial chemicals, is demonstrated to affect the health of a large number of workers.
  • There is increasing experimental and epidemiological evidence that chronic occupational exposure to benzene is associated with an increased risk of hematological malignancies such as acute myelogenous leukemia.
  • Several reports showed that epigenetic alterations in tumor supressor genes induced by occupational and environmental exposure to genotoxic chemicals play a significant role in early stages of cancer development.
  • Chronic occupational exposure to lower than the permissible exposure limit of benzene was associated with DNA methylation of p15INK4b gene.

Cite this article as: Jamebozorgi I, Majidizadeh T, Pouryaghoub G, Mahjoubi F. Aberrant DNA methylation of two tumor suppressor genes, p14ARF and p15INK4b, after chronic occupational exposure to low level of benzene. Int J Occup Environ Med 2018;9:145-151. doi: 10.15171/ijoem.2018.1317




 pISSN: 2008-6520
 eISSN: 2008-6814

Creative Commons LicenseThis work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License